circad | circRNAs associated with diseases

circ_0001721
Gene	CDK14	Organism	Human
Genome Locus	chr7:90355880-90356126:+	Build	hg19
Disease	Osteosarcoma	ICD-10	Malignant neoplasm of bone and articular cartilage of other and unspecified sites (C41)
DBLink	Link to database	PMID	30396080
Experimental Method
Sample Type	Tissues and Cell lines	Comparison	Circ_0001721 is overexpressed in OS tissues and cells
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CACCTAAAGTTAGGCGGCAC Reverse TGGGTCAAAAGTGCTCTGTG	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Li, L, Guo, L, Yin, G, Yu, G, Zhao, Y, Pan, Y (2019). Upregulation of circular RNA circ_0001721 predicts unfavorable prognosis in osteosarcoma and facilitates cell progression via sponging miR-569 and miR-599. Biomed. Pharmacother., 109:226-232.